G-Quadruplex Formation by DNA Sequences Deficient in Guanines: Two Tetrad Parallel Quadruplexes Do Not Fold Intramolecularly

Warning

This publication doesn't include Faculty of Economics and Administration. It includes Central European Institute of Technology. Official publication website can be found on muni.cz.
Authors

KEJNOVSKA I. STADLBAUER P. TRANTÍREK Lukáš RENCIUK D. GAJARSKÝ Martin KRAFČÍK Daniel PALACKY J. BEDNAROVA K. SPONER J. MERGNY J.L. VORLICKOVA M.

Year of publication 2021
Type Article in Periodical
Magazine / Source Chemistry - A European Journal
MU Faculty or unit

Central European Institute of Technology

Citation
web https://chemistry-europe.onlinelibrary.wiley.com/doi/10.1002/chem.202100895
Doi http://dx.doi.org/10.1002/chem.202100895
Keywords CD spectroscopy; DNA quadruplexes; G-quartets; nucleic acid folding; molecular dynamics calculations; NMR spectroscopy
Description Guanine quadruplexes (G4s) are noncanonical forms of nucleic acids that are frequently found in genomes. The stability of G4s depends, among other factors, on the number of G-tetrads. Three- or four-tetrad G4s and antiparallel two-tetrad G4s have been characterized experimentally; however, the existence of an intramolecular (i. e., not dimeric or multimeric) two-tetrad parallel-stranded DNA G4 has never been experimentally observed. Many sequences compatible with two-tetrad G4 can be found in important genomic regions, such as promoters, for which parallel G4s predominate. Using experimental and theoretical approaches, the propensity of the model sequence AATGGGTGGGTTTGGGTGGGTAA to form an intramolecular parallel-stranded G4 upon increasing the number of GGG-to-GG substitutions has been studied. Deletion of a single G leads to the formation of intramolecular G4s with a stacked G-triad, whose topology depends on the location of the deletion. Removal of another guanine from another G-tract leads to di- or multimeric G4s. Further deletions mostly prevent the formation of any stable G4. Thus, a solitary two-tetrad parallel DNA G4 is not thermodynamically stable and requires additional interactions through capping residues. However, transiently populated metastable two-tetrad species can associate to form stable dimers, the dynamic formation of which might play additional delicate roles in gene regulation. These findings provide essential information for bioinformatics studies searching for potential G4s in genomes.
Related projects:

You are running an old browser version. We recommend updating your browser to its latest version.

By clicking “Accept Cookies”, you agree to the storing of cookies on your device to enhance site navigation, analyze site usage, and assist in our marketing efforts. Cookie Settings

Necessary Only Accept Cookies